Prev. |  Human A to Z list >  G >  GATA6 > 

ARe07G01 - NRCD Human cDNA Clone

Catalog Number HKR042945
Clone Name ARe07G01
Clone info. Plasmid clone of human GATA6 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) GGCTCGCTGAGCGCAGTTCCGACCCACAGCCTGGCACCCTTCGGCGAGCGCTGTTTGTTT
Sequence, submitted(3) n.a.
 
Sequence, refered NM_005257.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) GATA6 (NCBI Gene 2627)  other clone of GATA6 in our bank
Synonyms -
Protein Name GATA binding protein 6
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR042945 ARe07G01 DNA solution JPY 9,460 plus cost of shipping containers, dry ice (if required) and shipping charge

How to cite this biological resource

Materials & Methods section:

The ARe07G01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR042945).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
ARe07G01a.seq       ARe07G01.pdf

References and tips

Featured content

Featured content EXR0077e (in English)
Featured content EXR0077j (in Japanese)

Reference

user_report Tomizawa, M., Transcription Factors and Medium Suitable for Initiating the Differentiation of Human Induced Pluripotent Stem Cells to the Hepatocyte Lineage. J. Cell. Biochem. 117 (9): 2001-2009 (2016). PMID 26773721.

♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
- - - - - - - - - - - - - - - - - - - -
piggyBac vector
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024) (BRC RESOURCE NEWS)
Sensor & Indicator
Virus gene resource
BAC & YAC
Microbial Genomic DNA
♦ ...and more DNA resources
♦ "Don't forget to follow us on Bluesky!"
BRC Resource News RIKEN BRC

2023.07.07

NRCDhumcloneList_AR_2023May03.csv - GNP_filter3_NRCD_html_230707.pl