Strain Information | |
---|---|
Image | |
BRC No. | RBRC06449 |
Type | CRISPR/Cas9 (Transgene)![]() |
Species | Mus musculus |
Strain name | C57BL/6-H3t<em1Osb> |
Former Common name | H3mmT KO, B6-H3mmT EN, H3mmT knockout mouse |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Jun Ueda and Kazuo Yamagata, Research Institute for Microbial Diseases, Osaka University and Kazumitsu Maehara, Akihito Harada and Yasuyuki Ohkawa, Graduate School of Medical Sciences, Kyushu University in 2013. Generated by injecting Cas9 and gRNA (GCAAGGGAGGCGGACGATTCAGG) expression plasmids into the C57BL/6 fertilized eggs. Off-target analysis was not examined. |
Strain description | Sperm specific histone H3 variant, H3mmT gene knockout mice. A 16 bp including ATG was deleted. Homozygous mutant males are infertile. |
Colony maintenance | Heterozygote x Wild-type [C57BL/6NCrSlc] |
References | Testis-Specific Histone Variant H3t Gene Is Essential for Entry into Spermatogenesis. Ueda J, Harada A, Urahama T, Machida S, Maehara K, Hada M, Makino Y, Nogami J, Horikoshi N, Osakabe A, Taguchi H, Tanaka H, Tachiwana H, Yao T, Yamada M, Iwamoto T, Isotani A, Ikawa M, Tachibana T, Okada Y, Kimura H, Ohkawa Y, Kurumizaka H, Yamagata K Cell Rep., 18(3):593-600 (2017). 28099840 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |||||||
---|---|---|---|---|---|---|---|
Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
Trim17 MGI:1861440 | tripartite motif-containing 17 | 11 | Trim17<em1Osb> | endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
Phenotype | |
---|---|
Annotation by Mammalian phenotyhpe ontology | more 4 phenotypes |
Detailed phenotype data |
Ordering Information | |
---|---|
Donor DNA | [hCas9 (addgene ID41815; CMV IE promoter, SV40 nls, human codon optimized Cas9*, neo*, TK pA), gRNA Cloning vector (addgene ID41824; human U6 polymerase III promoter, neo)] * Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). Other introduced genes were not tested. |
Research application | |
Specific Term and Conditions | Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Cell Rep., 18(3):593-600 (2017). In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. |
Depositor | Kazuo Yamagata (Osaka University) |
Strain Status | ![]() |
Strain Availability | Recovered litters from cryopreserved sperm (2 to 4 months) Cryopreserved sperm (within 1 month) |
Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
---|
No Data |