Strain Information | |
---|---|
Image | |
BRC No. | RBRC09957 |
Type | CRISPR/Cas9![]() |
Species | Mus musculus |
Strain name | B6D2-Col20a1<em1Osb> |
Former Common name | Col20a1<+4/+4> |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Daiji Kiyozumi and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. Fertilized eggs derived from BDF1×BDF1 were used. Mixed genetic background. |
Strain description | Col20a1 mutant mice generated by the CRISPR/Cas9 technique. 4 bp insertion at exon 2.Col20a1<em1Osb>: 4 bp insertion at exon 2.ggtcactggtaagtctgccttataccccaacttccaatcctgttgttacagTAAGTAGCCGC(AGTA)CTGAGGCTGGCAGTACTGCCTGAGGACCAGCTGCAGAT |
Colony maintenance | |
References | Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. Miyata H, Castaneda J M, Fujihara Y, Yu Z, Archambeault D R, Isotani A, Kiyozumi D, Kriseman M L, Mashiko D, Matsumura T, Matzuk R M, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk M M Proc. Natl. Acad. Sci. USA, 113(28):7704-10 (2016). 27357688 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |||||||
---|---|---|---|---|---|---|---|
Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
Col20a1 MGI:1920618 | collagen, type XX, alpha 1 | 2 | Col20a1<em1Osb> | endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
Phenotype | |
---|---|
Phenotype annotation from literatures by Mammalian phenotype ontology | |
Detailed phenotype data |
Ordering Information | |
---|---|
Donor DNA | human hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistance gene, Mouse a part of Col20a1 gene, human hU6 promoter |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc. Natl. Acad. Sci. USA, 113(28):7704-10 (2016). RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | ![]() |
Strain Availability | ![]() |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |