Strain Data Sheet
RBRC10014
Strain Information | |
|---|---|
| Image | |
| BRC No. | RBRC10014 |
| Type | CRISPR/Cas9 (Transgene) |
| Species | Mus musculus |
| Strain name | B6D2;B6-Plcz1<em1Osb> |
| Former Common name | Plcz1-50827/wt |
| H-2 Haplotype | |
| ES Cell line | EGR-G101 [C57BL/6NCr-Tg(CAG/Acr-EGFP)C3-N01-FJ002Osb] |
| Background strain | |
| Appearance | |
| Strain development | Developed by Kaori Nozawa and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. EGR-G01 ES cells derived from (129S2 x B6Cr)F1 were used. Mice were crossed to BDF1. Mixed genetic background. |
| Strain description | Plcz1 mutant mice. Deletion of 50827 bp genomic fragment around the Plcz1 gene.Plcz1<em1Osb>; 50827 bp deletion.AAAAGCGGTAGCAGCGAGAACAGCTGATGACGGTCACAAAAAGACAGTGTTACTTCTAAGACAAGTGACACCTTAGA-(50827 bp deletion)-CGAACCTTGAACCTTCCTCACTGTTTATTTATGTTTGGTACTTCAGAGAG |
| Colony maintenance | |
| References | Sperm-borne phospholipase C zeta-1 ensures monospermic fertilization in mice. Nozawa K, Satouh Y, Fujimoto T, Oji A, Ikawa M Sci. Rep., 8(1):1315 (2018). 29358633 |
Health Report | |
|---|---|
| Examination Date / Room / Rack | |
Gene | |||||||
|---|---|---|---|---|---|---|---|
| Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
| Plcz1 MGI:2150308 | phospholipase C, zeta 1 | 6 | Plcz1<em1Osb> | endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University | |||
Phenotype | |
|---|---|
| Annotation by Mammalian phenotyhpe ontology | |
| Detailed phenotype data | |
Ordering Information | |
|---|---|
| Donor DNA | human hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized)*, crRNA, tracrRNA, Escherichia coli ampicillin resistance gene, Mouse a part of Plcz1 gene* Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). E. coli Ampicillin resistance gene was not detected by PCR. Other introduced genes were not tested. |
| Research application | |
| Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci. Rep., 8(1):1315 (2018). In case RECIPIENT publishes the results of his or her research using BIOLOGICAL RESOURCE prior to the publications on the BIOLOGICAL RESOURCE by DEPOSITOR, RECIPIENT agrees to share authorship of such publication with DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
| Depositor | Masahito Ikawa (Osaka University) |
| Strain Status |  Frozen embryos Frozen sperm |
| Strain Availability | Recovered litters from cryopreserved sperm (2 to 4 months) Cryopreserved sperm (within 1 month) |
| Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
|---|
Hirose N, Kikuchi Y, Kageyama A, Sugita H, Sakurai M, Kawata Y, Terakawa J, Wakayama T, Ito J, Kashiwazaki N. Successful Production of Offspring Derived from Phospholipase C Zeta-Deficient Sperm by Additional Artificial Activation. Life (Basel) 13(4) (2023) 37109509 |