Strain Data Sheet

RBRC10057

Strain Information

Image
BRC No.RBRC10057
TypeSpontaneous Mutation Congenic
SpeciesMus musculus
Strain nameB6.Cg-Eif2b5<toy>
Former Common nameB6Toy, Eif2b5<I98M>
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Mika Tsujita, Brain Research Institute, Niigata University in 2008. Point mutation was identified in 2012. C57BL/6 genetic background.
Strain descriptionSpontaneous mutants exhibiting phenotypes similar to the Vanishing white matter disease. A point mutation (I98M) in the Eif2b5 (eukaryotic translation initiation factor 2B, subunit 5 epsilon) gene. Homozygous mutants show decreased body weight (starting around 3 weeks old) and impaired motor coordination. Homozygous mice are infertile, but sperms can be used for in vitro fertilization. WT: GCTGCTCAGATCAAAGAACACTTAToy: GCTGCTCAGATGAAAGAACACTTA
Colony maintenance
References
Glial pathology in a novel spontaneous mutant mouse of the Eif2b5 gene: a vanishing white matter disease model.
Terumitsu-Tsujita M, Kitaura H, Miura I, Kiyama Y, Goto F, Muraki Y, Ominato S, Hara N, Simankova A, Bizen N, Kashiwagi K, Ito T, Toyoshima Y, Kakita A, Manabe T, Wakana S, Takebayashi H, Igarashi H
J. Neurochem., 154(1):25-40 (2020). 31587290

Health Report

Examination Date / Room / Rack2023/11/20Room:4-ARack:DSentinel mouse program
2023/08/21Room:4-ARack:DSentinel mouse program

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Eif2b5
MGI:2446176
eukaryotic translation initiation factor 2B, subunit 5 epsilon16Eif2b5<toy> eukaryotic translation initiation factor 2B, subunit 5 epsilon; toy
  • leukoencephalopathy with vanishing white matter(DisGeNET)

  • obsolete leukoencephalopathy with vanishing white matter(MedGEN)
  • Phenotype

    Phenotype annotation from literatures by Mammalian phenotype ontology
  • athetotic walking movements (MP:0001527)

  • premature death (MP:0002083)
  • Detailed phenotype data

    Ordering Information

    Donor DNA
    Research application
    Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Neurochem., 154(1):25-40 (2020).
    DepositorMika Terumitsu-Tsujita (Niigata University)
    Strain Statusan icon for Frozen embryosFrozen embryos
    an icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovered litters from cryopreserved embryos (2 to 4 months)
    Cryopreserved sperm (within 1 month)
    Cryopreserved embryos (within 1 month)
    Additional Info.Necessary documents for ordering:
    1. Order form (Japanese / English)
    2. Category I MTA: MTA for distribution with RIKEN BRC (Japanese / English)

    Genotyping protocol -PCR-
    Mouse of the Month Oct 2021

    BRC mice in Publications

    No Data