Strain Information | |
---|---|
Image | |
BRC No. | RBRC10058 |
Type | Spontaneous Mutation Congenic |
Species | Mus musculus |
Strain name | C3H.Cg-Eif2b5<toy> |
Former Common name | C3HToy, Eif2b5<I98M> |
H-2 Haplotype | |
ES Cell line | |
Background strain | C3H/HeNCrl |
Appearance | |
Strain development | Developed by Mika Tsujita, Brain Research Institute, Niigata University in 2008. Point mutation was identified in 2012. C3H/HeN genetic background. |
Strain description | Spontaneous mutants exhibiting phenotypes similar to the Vanishing white matter disease. A point mutation (I98M) in the Eif2b5 (eukaryotic translation initiation factor 2B, subunit 5 epsilon) gene. Homozygous mutants show decreased body weight (starting around 3 weeks old) and impaired motor coordination. Homozygous mice are infertile, but sperms can be used for in vitro fertilization. WT: GCTGCTCAGATCAAAGAACACTTAToy: GCTGCTCAGATGAAAGAACACTTA |
Colony maintenance | |
References | J. Neurochem., 154(1):25-40 (2020). 31587290 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Eif2b5eukaryotic translation initiation factor 2B, subunit 5 epsilon16Eif2b5<toy>eukaryotic translation initiation factor 2B, subunit 5 epsilon; toyEif2b5^I98M |
Ordering Information | |
---|---|
Donor DNA | |
Research application | |
Specific Term and Conditions | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Neurochem., 154(1):25-40 (2020). |
Depositor | Mika Terumitsu-Tsujita (Niigata University) |
Strain Status | Frozen sperm |
Strain Availability | Recovered litters from cryopreserved sperm (2 to 4 months) Cryopreserved sperm (within 1 month) |
Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
---|
No Data |