Strain Data Sheet

RBRC10096

Strain Information

Image
BRC No.RBRC10096
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameC57BL/6J-Hr<em1Utr>
Former Common nameHrem1Utr/em1Utr
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Fumihiro Sugiyama and his colleague, Laboratory animal resource center, University of Tsukuba in 2014. With the CRISPR/Cas9, 5 bp deletion was introduced into exon 3 of Hr (hairless) gene. C57BL/6J genetic background.
Strain descriptionMutant strain harboring c.63_67delCGGCA mutation in the Hr (hairless) gene. Homozygous mutant shows the hairless phenotype starting around 3 weeks old. Hr<em1Utr>; 5 bp deletion at exon 3AGCCCCTGTGAACGGCATTGTGGG
Colony maintenance
References
Simple generation of hairless mice for in vivo imaging.
Hoshino Y, Mizuno S, Kato K, Mizuno-Iijima S, Tanimoto Y, Ishida M, Kajiwara N, Sakasai T, Miwa Y, Takahashi S, Yagami K I, Sugiyama F
Exp. Anim., 66(4):437-445 (2017). 28717054

Health Report

Examination Date / Room / Rack2024/08/26Room:4-BRack:GSentinel mouse program
2024/05/27Room:4-BRack:GSentinel mouse program
2024/02/26Room:4-BRack:GSentinel mouse program
2023/11/27Room:4-BRack:GSentinel mouse program
2023/08/28Room:4-BRack:GSentinel mouse program
2023/05/29Room:4-BRack:GSentinel mouse program

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Hr
MGI:96223		lysine demethylase and nuclear receptor corepressor14Hr<em1Utr> endonuclease-mediated mutation 1, University of Tsukuba Laboratory Animal Resource Center
  • alopecia universalis congenita(DisGeNET, MedGEN)

  • atrichia with papular lesions(DisGeNET, MedGEN)

    • Phenotype

    Annotation by Mammalian phenotyhpe ontology
  • hairless(MP:0003815)
    • Detailed phenotype data

    Ordering Information

    Donor DNApX330-U6-Chimeric_BB-CBh-hSpCas9[human U6 promoter, S. pyogenes gRNA scaffold, human U6 terminator, CMV,chicken hybrid CMV enhancer/chicken beta-actin promoter (CBh), Synthetic DNA 3xFLAG, SV40 nuclear localization signal(NLS), Streptococcus pyogenes SpCas9* (human codon-optimized), bovine GH polyA signal, AAV2 inverted terminal repeat (ITR), f1 phage f1 origin, E. coli pUC origin]* Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). E. coli Ampicillin resistance gene was not detected by PCR. Other introduced genes were not tested.
    Research application
    Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Exp. Anim., 66(4):437-445 (2017).
    DepositorFumihiro Sugiyama (University of Tsukuba)
    Strain Statusan icon for Frozen embryosFrozen embryos
    an icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovered litters from cryopreserved embryos (2 to 4 months)
    Cryopreserved sperm (within 1 month)
    Cryopreserved embryos (within 1 month)
    Additional Info.Necessary documents for ordering:
    1. Order form (Japanese / English)
    2. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
    3. Acceptance of responsibility for living modified organism (Japanese / English)

    Genotyping protocol -PCR-
    Mouse of the Month Feb 2020

    BRC mice in Publications

    No Data