Strain Information | |
---|---|
Image | |
BRC No. | RBRC10099 |
Type | CRISPR/Cas9![]() |
Species | Mus musculus |
Strain name | C57BL/6-Riok3<em1Tsse> |
Former Common name | RIOK3 KO Cr1/Cr1 |
H-2 Haplotype | |
ES Cell line | |
Background strain | C57BL/6JJcl |
Appearance | |
Strain development | Developed by Ken Takashima and Hiroyuki Oshiumi, Graduate School of Medicine, Hokkaido University. With the CRISPR/Cas9, a frameshift mutation was introduced into exon 4 of the Riok3 gene. C57BL/6 genetic background. Homozygous mice are viable. |
Strain description | Riok3 (RIO kinase 3) mutant mice. One base pair insertion at Exon 4 causing the frameshift mutation. Lack of Riok3 protein was confirmed. Riok3<em1Tsse>; 1 bp insertion at exon 4ACAGCTCTGAAGACGAGGTT(T)GACTGGCAGGACAC |
Colony maintenance | |
References | RIOK3-mediated phosphorylation of MDA5 interferes with its assembly and attenuates the innate immune response. Takashima K, Oshiumi H, Takaki H, Matsumoto M, Seya T Cell Rep.,11(2), 192-200 (2015). 25865883 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |||||||
---|---|---|---|---|---|---|---|
Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
Riok3 MGI:1914128 | RIO kinase 3 | 18 | Riok3<em1Tsse> | endonuclease-mediated mutation 1, Tsukasa Seya |
Phenotype | |
---|---|
Phenotype annotation from literatures by Mammalian phenotype ontology | |
Detailed phenotype data |
Ordering Information | |
---|---|
Donor DNA | |
Research application | Immunology and Inflammation Research |
Specific Term and Conditions | Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Cell Rep.,11(2), 192-200 (2015). |
Depositor | Tsukasa Seya (Hokkaido University) |
Strain Status | ![]() |
Strain Availability | Recovered litters from cryopreserved sperm (2 to 4 months) Cryopreserved sperm (within 1 month) |
Additional Info. | Necessary documents for ordering: |
BRC mice in Publications |
---|
No Data |