Strain Data Sheet

RBRC10100

Strain Information

Image
BRC No.RBRC10100
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameC57BL/6-Riok3<em2Tsse>
Former Common nameRIOK3 KO Cr8/Cr8
H-2 Haplotype
ES Cell line
Background strainC57BL/6JJcl
Appearance
Strain developmentDeveloped by Ken Takashima and Hiroyuki Oshiumi, Graduate School of Medicine, Hokkaido University. With the CRISPR/Cas9, a frameshift mutation was introduced into exon 4 of the Riok3 gene. C57BL/6 genetic background. Homozygous mice are viable.
Strain descriptionRiok3 (RIO kinase 3) mutant mice. 8 base pairs deletion at Exon 4 causing the frameshift mutation. Lack of Riok3 protein was confirmed. Riok3<em2Tsse>; 8 bp deletion at exon 4ACAGCTCTGAAGACGAGGTTGACTGGCAGGACACT
Colony maintenance
References
RIOK3-mediated phosphorylation of MDA5 interferes with its assembly and attenuates the innate immune response.
Takashima K, Oshiumi H, Takaki H, Matsumoto M, Seya T
Cell Rep.,11(2), 192-200 (2015). 25865883

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Riok3
MGI:1914128
RIO kinase 318Riok3<em2Tsse> endonuclease-mediated mutation 2, Tsukasa Seya

Phenotype

Phenotype annotation from literatures by Mammalian phenotype ontology
  • increased anti-double stranded DNA antibody level (MP:0004762)

  • increased interferon-alpha secretion (MP:0008562)

  • increased interferon-beta secretion (MP:0008564)

  • increased macrophage cytokine production (MP:0011078)
  • Detailed phenotype data

    Ordering Information

    Donor DNA
    Research applicationImmunology and Inflammation Research
    Specific Term and ConditionsPrior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Cell Rep.,11(2), 192-200 (2015).
    DepositorTsukasa Seya (Hokkaido University)
    Strain Statusan icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
    Cryopreserved sperm (within 1 month)
    Additional Info.Necessary documents for ordering:
    1. Approval form (Japanese / English)
    2. Order form (Japanese / English)
    3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
    4. Acceptance of responsibility for living modified organism (Japanese / English)

    BRC mice in Publications

    No Data