Strain Data Sheet

RBRC10387

Strain Information

Image
BRC No.RBRC10387
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameC57BL/6-Pld2<em1Yaka>
Former Common namePLD2-KO (CRISPR/Cas9)
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Yasunori Kanaho and NGO THAI BICH VAN, University of Tsukuba in 2016. This strain was generated using fertilized eggs derived from C57BL/6J with the CRISPR/Cas9.
Strain descriptionPld2 (phospholipase D2) mutant mice generated by the CRISPR/Cas9. Stop codon was introduced at Exon 3 of the Pld2 gene. Pld2<em1Yaka>:gcctctgaaagcacaccccttggtgttcg(AATTCGACTACAAAGACGATGACGACAAGTGATTGACTAGG)cccctggggtccctgttat
Colony maintenance
References
Physiological function of phospholipase D2 in anti-tumor immunity: regulation of CD8(+) T lymphocyte proliferation.
Ngo Thai Bich V, Hongu T, Miura Y, Katagiri N, Ohbayashi N, Yamashita-Kanemaru Y, Shibuya A, Funakoshi Y, Kanaho Y
Sci. Rep., 8(1) 6283 (2018). 29674728

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
FLAG FLAG tag (synthetic)11FLAG
Pld2
MGI:892877
phospholipase D211Pld2<em1Yaka> endonuclease-mediated mutation 1, Yasunori Kanaho

Phenotype

Annotation by Mammalian phenotyhpe ontology
  • no abnormal phenotype detected(MP:0002169)
  • Detailed phenotype data

    Ordering Information

    Donor DNApX330-U6-Chimeric_BB-CBh-hSpCas9[human U6 promoter, S. pyogenes gRNA scaffold, human U6 terminator, CMV,chicken hybrid CMV enhancer/chicken beta-actin promoter (CBh), Synthetic DNA 3xFLAG, SV40 nuclear localization signal(NLS), Streptococcus pyogenes SpCas9 (human codon-optimized), bovine GH polyA signal, AAV2 inverted terminal repeat (ITR), f1 phage f1 origin, E. coli Ampicillin resistance gene (AmpR), E. coli pUC origin], FLAG tag sequence (synthetic)
    Research application
    Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci. Rep., 8(1), 6283 (2018).In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit institution for a not-for-profit research.
    DepositorYasunori Kanaho (University of Tsukuba)
    Strain Statusan icon for Frozen embryosFrozen embryos
    an icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
    Cryopreserved sperm (within 1 month)
    Additional Info.Necessary documents for ordering:
    1. Order form (Japanese / English)
    2. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
    3. Acceptance of responsibility for living modified organism (Japanese / English)

    Genotyping protocol -PCR-

    BRC mice in Publications

    No Data