ARe17H05 NRCD Human cDNA Clone

Prev. | Human A to Z list > F > FGF2 >

ARe17H05 - NRCD Human cDNA Clone


Catalog Number	HKR046973
Clone Name	ARe17H05
Clone info.	Plasmid clone of human FGF2 cDNA with SV40 promoter
Vector⁽¹⁾	pKA1U5
5'-terminal sequence⁽²⁾	ATCCTGGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGC
Sequence, submitted⁽³⁾	n.a.
Note	match to NM_002006.6 (128-4028) CDS:parcial/var
Sequence, refered	NM_002006.6 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	FGF2 (NCBI Gene 2247) other clone of FGF2 in our bank
Synonyms	BFGF\|FGF-2\|FGFB\|HBGF-2
Protein Name	fibroblast growth factor 2

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR046973	ARe17H05	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe17H05 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR046973).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
ARe17H05a.seq		ARe17H05c.seq	ARe17H05z.seq	ARe17H05.pdf